Skip to main content

Table 1 List of primers used for quantitative real-time PCR of genes

From: Evaluation of anti-epithelial-mesenchymal transition property of Garcinia mangostana rind extract

S. no Gene 5′ → 3′ sequence
1 ER alpha F TGGGCTTACTGACCAACCTG
   R CCTGATCATGGAGGGTCAAA
2 ER beta F AGAGTCCCTGGTGTGAAGCAA
   R GACAGCGCAGAAGTGAGCATC
3 EGFR F CTAAGATCCCGTCCATCGCC
   R GGAGCCCAGCACTTTGATCT
4 E Cadherin F GCCGCTGGCGTCTGTAGGAA
   R TGACCACCGCTCTCCTCCGA
5 N Cadherin F TCGCCATCCAGACCGACCCA
   R TGAGGCGGGTGCTGAATTCCC
6 SNAIL F ATGCCGCGCTCTTTCCTCGTC
   R AGCAGGTGGGCCTGGTCGTAG
7 GAPDH F TCAAGTGGGGCGATGCTGGC
   R TGACCTTGGCCAGGGGTGCT
  1. F, Forward; R, Reverse