Skip to main content

Table 1 Sequence of primers used for gene amplification

From: Chemopreventive potential of plant-derived epigenetic inhibitors silibinin and quercetin: an involvement of apoptotic signaling cascade modulation

Gene Forward primer (5′ to 3′) Reverse primer (3′ to 5′) Amplicon size
p53 GGCGCACAGAGGAAGAGAAT CTTCAGGTGGCTGGAGTGAG 266
Bcl2 CCCGCGACTCCTGATTCATT GTTTCCCCCTTGGCATGAGA 265
GAPDH CATGAGAAGTATGACAACAGCCT CCGTTCAGCTCAGGGATGAC 269